The Science Behind iDNAtity

  • Facebook
  • Twitter
  • Add to favorites

Ever wondered what your DNA sounds like?

Well step inside the world of iDNAtity and listen to your DNA!

Our crazy scientists have created an App that converts your unique genetic code into musical notes. Using our exclusive iDNAtity scanner ­– along with some simple questions about your physical characteristics – you can create music from your genes!

Making music from genes:

The iDNAtity audio App shows how you can be creative with science by using a little imagination. If you think of DNA as a code of life and notes as a code of music, then with some ingenuity, an inventive arbitrary conversion can be applied to convert DNA into music! What does this mean and how does it work?

A DNA Code:

GAGTTTGATCCTGGTTCAGGACTACGCTGGCGGCGT

A Musical Code;

science_behind_iDNA_img_1

The DNA letters, A G C T are the codes of life, just like notes are codes for music!

iDNAtity audio has tried to stay as scientifically accurate as possible in its conversion of DNA into music. In the biological world, the DNA code reads in nucleotide triplets which produce chains of amino acids to form a protein strand, see “ABOUT DNA SCIENCE” figure 4. In the iDNAtity world, iDNAtity audio adds an alternative step and codes the DNA into music, using Table 1 as the arbitrary conversion.

The DNA strand;

GAG TTT GAT CCT GGT TCA GGA CTA CGC TGG CGG CGT

The protein strand;

Glu-Phe-Asp-Pro-Gly-Ser-Gly-Leu-Arg-Trp-Arg-Arg

The music strand (Hz);

1661-55-1397-440-1760-78-1980-392-740-131-831-698

science_behind_iDNA_img_2

Figure 1: The crazy scientist showing how a chromosome is made up of a long strand of piano keys. The codons on the piano keys code for chains of notes which make up the music.

Crazy scientist in figure 1 shows how the chromosome unwinds into a long strand of piano keys. We can read the piano key codons as GAG TTT GAT CCT GGT TCA GGA CTA CGC TGG CGG CGT. Using Table 1 as a reference, we can convert the piano key codons into a chain of notes (Hz) 1661-55-1397-440-1760-78-1980-392-740-131-831-698. This chain of notes then folds into music.

Phenotype Profiling Page:

The questions asked about the App user’s profile are all questions that genetic scientists have discovered the complete or partial DNA sequences that code for each particular phenotype. For example the gene for eye colour is called the OCA2 gene and is located on the human chromosome 15. To find this gene click on - http://www.ncbi.nlm.nih.gov/projects/genome/guide/human – click on chromosome 15 and down the long arm of the chromosome – click on Hs.654411, Oculocutaneous albinism II. This nucleotide sequence for the eye colour gene was used to create the genotype profile of the App user. In a similar manner, the nucleotide sequences for the other phenotype profiling questions are used to create the users genotype profile and ultimately their unique iDNAtity audio.

Genotype Profile Page:

Your DNA code found on the genotype profile page is a partial nucleotide sequence. iDNAtity’s arbitrary conversion, described above, converts this sequence into your unique DNA audio. With a choice of instruments that suits your musical taste, why not save the audio on your device, email to yourself or share with others via Facebook and/or Twitter.

science_behind_iDNA_img_3

T    full note (f)
A   1/2 note (h)
C   1/4 note (q)
G   1/8 note (e)

NB: The note length is read first followed by the codons – frequency conversion

Table 1: The musical code of iDNAtity audio: from this table showing all 64 codons, you can see that each codon encodes for a specific note. E.g. GCT codes for 1109 Hz, TAT codes for 87 Hz. Also the nucleotide letter directly before the codon determines the length of the note. E.g. TGCT codes for a full note of 1109 Hz and GTAT codes for an eighth of 87 Hz.

  • Facebook
  • Twitter
  • Add to favorites
Watch our app's own awesome video!
Buy now!